MLST of IncI blaCTX-M plasmid in German outbreak strain

Overnight I received an email from Scott Weissman at the Seattle Children’s Hospital. He has done some analysis of the IncI, blaCTX-M bearing plasmid from the outbreak strain using the plasmid MLST database. Here’s what he did:

To facilitate comparisons to other plasmids, I analyzed the LB226692 contigs in order to identify a plasmid Sequence Type (pST) for this outbreak strain’s IncI1 plasmid carrying CTX-M-15 and TEM-1.  I extracted fragments for the 5 MLST loci (as described at http://pubmlst.org/plasmid/primers/incI1.shtml) from the GenBank contigs, and obtained allele assignments as follows: repI 3 | ardA 4 | trbA 6| sogS 3 | pilL 3, which corresponds to pST31.  (I should note that the extracted sequence for trbA contained a 1-nt “insertion” relative to reference allele 6, which I assume to be sequencing artifact, although a novel allele cannot be excluded – given the indel occurrence within a poly-T tract of 4 T’s).

The database contains 15 plasmid entries for IncI1 pST31 (see below), including pEC_Bactec (described by Smet et al, PLoS One, 2011;5:e11202).  All of these entries carry the CTX-M-15 and TEM-1 enzymes, so there are no headlines here.

I would note, however, that this CTX-M-15 plasmid is distinct from the IncF-family plasmids that have been globally distributed by E. coli ST131 (eg, pC15a-1a, as described by Boyd et al, AAC 2004;48:3758-64) and detected subsequently in multiple Klebsiella pneumoniae clones (see Oteo et al, JAC, 2009;64:524-528).

IncI pST31 entries in the IncI pMLST database

To supplement this I had a quick look at the latest BGI assembly of TY2482, the other outbreak strain that has been sequenced. I found the same results, but this time with a precise trbA allele 6 (i.e. Scott was right in guessing this is an error in the Ion Torrent data at a homopolymeric tract).

Re the table above, the paper describing the 2004 Shigella sonnei plasmid is here, I’m not sure if the others are published.

This is what the eBURST diagram looks like for the data in the IncI plasmid MLST database…the German outbreak sequence type, pST31, is pointed out with a red arrow.

eBurst diagram for IncI plasmid MLST

The pMLST sequences from TY2482 (BGI assembly 2, June 6) are:

>repI1-3
 GAGAGATGGCATGTACGGGCAGTAAGTCAGAAGACTGAAGATGCTCCGGAAGCCATAAAA
 GGAAAACCCCCACTATCTTTCTTACGAACTTGGCGGAACGACGAA
 >ardA-4
 AATACAACTGTGGAAGCATCGCCGGACGCTGGTTTGACCTGACCACGTTTGATGATGAGC
 GCGACTTTTTCGCCGCCTGCCGTGCTCTTCACCAGGATGAAGCCGATCCTGAACTGATGT
 TTCAGGATTATGAGGGATTCCCGGGGAATATGGCCTCTGAATGCCATATCAACTGGGCCT
 GGGTTGAAGGCTTCCGCCTGGCACGGGATGAAGGCTGCGAAGAGGCTTATCGTCTCTGGG
 TGGAGGATACCGGTGAGACGGATTTTGACACCTTCCGCGATGCCTGGTGGGGCGAGGCTG
 ACAGTGAGGAGGCTTTTGCGGTTGAGTTCGCCAGTGATACCGG
 >trbA-6
 GCAACCCGCCGCTCAGGCCGTTTGCCACCATGAAAGAGTTTTTCCGGATCACCATCTGCC
 AGTACTGGGGCGATAGCAGGGGACAACGAGGCAAAGATGTGTGGCAGTCGGGTAATATCT
 ACAGGTCTGCGGGTGAAACGGCTTTGTCCCGGGTGTTGATACCATTCCCATAAACACCAG
 AGTGTCACAGGTAAAAGATACATCCACAGAATACCTATGGTCTGCTCCATGACGTTAATC
 CACTGGCTATAGCTTATGTTGGCGGCGTTGTTACCGGTCATGGCAAGCAGGTTGTATCGT
 GGTGCTGCATAGTTATGAAATGGTCCCCAGTCGACCAGTCCCCATAAGGTATGAAGAATC
 AGGCAGCTGGCGTAAACCACTTCCGGCAAGAATAACCATATGACGAATAGCAGCAGGATA
 AGAAGGACACCAACAGCGCCCCATATCTGCATAGGATCTTCTGCGACAGGCTGTCGATTG
 TAAGA
 >sogS-3
 GTCGTCGTGGTTTCCGCTGAGGGCGTGGGATCACTGTTCTCATGCGCCTGTGAATCCGTT
 TTTTTACGCGTAAAAAGGCCACGCGCTTTGTCGAGAAACGATGAAGTATTATCAGAAGGT
 GATGTGCTCTGAACAGGTTGCTGCGGAGTGGGTTCATCCCGGACAGCCGGTTCTATAGTG
 GCTGTTGTGGCCTGAAGTTCTGACTCATCTGCCTGAACGTGGCCTGTGTCCGGTTGCGAC
 GGCATATCACTGTT
 >pilL-3
 TTGATGCCATGCTTTCGCATTTTGTTTCTTCTGCCCACTTAATAATGTTTTCCCTTAATG
 TAGTGCCTGCCGGCGCACGCCACTCTTTACCCTGAGATACCGGTTTGACAGGTGTCCCGG
 TCATGAGTGGGATAGACTTGACTGTAGAGCCGGTCGGAGTCGGGATTGCTGCGGGCGTAG
 ACGGAGATACGCTGTTTCCCCTGAATGGGTTTCGTGGTTTGTTCTGGCTATTTGCTGTCG
 TTGAAGACTCCGGGGAAGTGGATGTGGTTACCATGG
Advertisements

EHEC genomes – plasmid

A brief look at the genes present in the outbreak strains and not in the reference strain Ec55989 reveals a large number of contigs with similarity to the plasmid pEC_Bactec (by NCBI blast)… a quick MUMmer alignment and ACT visualisation confirms that an IncI plasmid similar to pEC_bactec (GU371927.1, ref here) is present, including the beta-lactamase gene CTX-M-15 adjacent to ISEcp1 (MIRA assembly of TY2482, contig husec41_c30). In this image, the TW2482 assembly is on top, pEC_Bactec is on bottom.

MIRA assembly of TW2482 vs pEC_Bactec

Update: Note this is also similar to pEK204, which was isolated from UPEC and we have recently found very similar plasmids (also carrying blaCTX-M-15) circulating in Shigella in Vietnam and Klebsiella pneumoniae in Australia. So this would seem to be spreading around the Enterobacteriaceae.