Typing of German E. coli

I know a lot of people will have seen this from other sources, but the people at Am Institut für Hygiene at Münster University have some very useful strain typing data on HUSEC publicly available here. You can see that there is an entry of HUSEC of serotype O104:H4, ST678 (same as the current outbreak), strain 01-09591 from 2001, carrying stx2 & terE but not saa; this matches the current HUSEC strains. On June 6, Münster university announced they had sequenced this older strain, however no data or analysis has been released yet.

Münster have also released a multiplex PCR for typing the outbreak strain, which incorporates primers for stx2, terD, rfbO (for O104) and flicH4 (for H4). So this will capture the presence of Shiga toxin, tellurite resistance, and O104:H4 serotype. Seems pretty comprehensive, although I’m not sure how useful the detection of tellurite resistance is since it seems to be quite widely distributed in enterohemorrhagic E. coli (see my tree of ter operon here).

Yesterday, BGI released their own typing scheme, targeting stx2 and what they call AFF_I-2 (primers F-CAGTCAGGAAAGTGGGAAAGC, R-AGGTCTGTATAGTGCCGTCTG). I’m pretty sure this is a typo and they mean AAF/I, i.e. aggregative adhesive fimbriae type I. Their primers target the aggC gene of the AAF/I gene cluster, see EMBL file showing off agg operon and primer binding sites here.

This is exactly what I suggested a few days ago based on the detection of stx2 and AAF/I fimbrial cluster (agg operon) in the outbreak strain (as opposed to the AAF/II operon found in Ec55989). The rationale for me was that this combination tells you that you have an enteroaggregative E. coli (and a specific type of aggregative fimbriae) in combination with Shiga toxin, which tells you that it is not a typical EHEC, and is more informative than any old EAEC + shiga toxin. I don’t have access to databases which would show how rare this combination is, but given that the AAF/I cluster is not present in any GenBank genomes, I would hazard a guess it is at least somewhat rare.

So it seems to me the best option would be a combination of the two schemes – take the Münster scheme and replace terD primers with aggC primers, to end up with stx2, aggC, rfbO and flicH4. This will give a definitive diagnosis of serotype O104:H4 enteroaggregative E. coli (AAF/I type) producing Shiga-toxin.

Advertisements

6 thoughts on “Typing of German E. coli

    • Sure, here they are:

      >rfbO Ec55989
      TTGTATATCATAATGAAATTTAGCGTTCTGTTATCCCTGTATTACAAAGAGTCTGCACTT
      TTTCTGCATGATTGTTTAGAAAGTATAGCAAGCAATACATGCGCACCTGATCAAATTGTA
      ATTGTCTTTGATGGTTATATTAGTGATGATTTGCTACATGTTGTTAATGAATTTTCATCA
      CGTTTACCCATTGATATTGTGCGATTAAGTAATAATGTTGGTCTAGGTAAGGCTCTTAAT
      CATGGTCTACAGTATTGTCGCAATGAACTGATTTTTAGGATGGATACTGATGATATTTGT
      TTGCCTGAACGGTTCGCTCTTCAACTTAGCTATATGAAATCACACCCTGAAGTTGTTCTT
      TTGGGAAGTGCCATTGAAGAATTTGATAATACAATGAAAATTAGGCAAGGAAAAAGATTT
      TCAGTTATATACCATGAAGATATAAAAAAATTTGCAAAAAAAAGAAATCCTTTCAACCAT
      ATGACTGTTGTTTTCAGAAAGTCCGTAATTGAAAAGCTTGGTGGATATCAACATCATTAT
      CTAATGGAAGATTATAACTTATGGCTTAGGATACTTGCAGCCGATTATCGCACTCATAAT
      TTGAGTGAGGTTCTTGTTAATGTTCGGGCAGGCAGAAATATGCTGTGTCGACGGAAAGGA
      TATTCCTATATTAGGAGTGAGATTCTTTTGGCGAAATTAAAATATGAATTACAGTTGGAT
      AATCTGACAGGTGTCATATATACAGGTGTAATTCGTATTATCCCTAGAATATTGCCTGTT
      TCATTACTGAAATTAGTATACAATATATTGCGGAAATAA
      >fliC Ec55989
      ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCACTCAGAACAACATCAACAAA
      AACCAGTCTGCGCTGTCGACTTCTATCGAGCGCCTCTCTTCTGGTCTGCGTATTAACAGC
      GCTAAAGATGACGCCGCGGGCCAGGCGATTGCTAACCGCTTTACTTCTAACATCAAAGGT
      CTGACTCAGGCCGCACGTAACGCCAACGACGGTATTTCTCTGGCGCAGACGGCTGAAGGC
      GCGCTGTCAGAGATTAACAACAACTTGCAGCGTATTCGTGAACTGACCGTTCAGGCCTCT
      ACCGGCACGAACTCTGATTCCGACCTGTCTTCTATTCAGGACGAAATCAAATCCCGTCTT
      GATGAAATTGACCGTGTATCTGGTCAGACCCAGTTCAACGGTGTGAACGTGCTGTCGAAA
      AACGATTCGATGAAGATTCAGATTGGTGCCAATGATAACCAGACGATCAGCATTGGCTTG
      CAACAAATCGACAGTACCACTTTGAATCTGAAAGGATTTACCGTGTCCGGCATGGCGGAT
      TTCAGCGCGGCGAAACTGACGGCTGCTGATGGTACAGCAATTGCTGCTGCGGATGTCAAG
      GATGCTGGGGGTAAACAAGTCAATTTACTGTCTTACACTGACACCGCGTCTAACAGTACT
      AAATATGCGGTCGTTGATTCTGCAACCGGTAAATACATGGAAGCCACTGTAGTCATTACC
      GGTACGGCGGCGGCGGTAACTGTTGGTGCAGCGGAAGTGGCGGGAGCCGCTACAGCCGAT
      CCGTTAAAAGCACTGGATGCCGCAATCGCTAAAGTCGACAAATTCCGCTCCTCCCTCGGT
      GCCGTTCAAAACCGTCTGGATTCTGCGGTCACCAACCTGAACAACACCACCACCAACCTG
      TCTGAAGCGCAGTCCCGTATTCAGGACGCCGACTATGCGACCGAAGTGTCCAACATGTCG
      AAAGCGCAGATTATCCAGCAGGCGGGCAACTCCGTGCTGTCTAAAGCCAACCAGGTACCG
      CAGCAAGTTCTGTCTCTGTTACAAGGCTAA
      >stx2
      ATGAAGTGTATATTATTTAAATGGGTACTGTGCCTGTTACTGGGTTTTTCTTCGGTATCC
      TATTCCCGGGAGTTTACGATAGACTTTTCGACCCAACAAAGTTATGTCTCTTCGTTAAAT
      AGTATACGGACAGAGATATCGACCCCTCTTGAACATATATCTCAGGGGACCACATCGGTG
      TCTGTTATTAACCACACCCCACCGGGCAGTTATTTTGCTGTGGATATACGAGGGCTTGAT
      GTCTATCAGGCGCGTTTTGACCATCTTCGTCTGATTATTGAGCAAAATAATTTATATGTG
      GCCGGGTTCGTTAATACGGCAACAAATACTTTCTACCGTTTTTCAGATTTTACACATATA
      TCAGTGCCCGGTGTGACAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAA
      CGTGTCGCAGCGCTGGAACGTTCCGGAATGCAAATCAGTCGTCACTCACTGGTTTCATCA
      TATCTGGCGTTAATGGAGTTCAGTGGTAATACAATGACCAGAGATGCATCCAGAGCAGTT
      CTGCGTTTTGTCACTGTCACAGCAGAAGCCTTACGCTTCAGGCAGATACAGAGAGAATTT
      CGTCAGGCACTGTCTGAAACTGCTCCTGTGTATACGATGACGCCGGGAGACGTGGACCTC
      ACTCTGAACTGGGGGCGAATCAGCAATGTGCTTCCGGAGTATCGGGGAGAGGATGGTGTC
      AGAGTGGGGAGAATATCCTTTAATAATATATCAGCGATACTGGGGACTGTGGCCGTTATA
      CTGAATTGCCATCATCA-GGGGGCGCGTTCTGTTCGCGCCGTGAATGAATGAAGAAGATG
      TTTATGGCGGTTTTATTTGCATTAGCTTCTGTTAATGCAATGGCGGCGGATTGTGCTAAA
      GGTAAAATTGAGTTTTCCAAGTATAATGAGGATGACACATTTACAGTGAAGGTTGACGGG
      AAAGAATACTGGACCAGTCGCTGGAATCTGCAACCGTTACTGCAAAGTGCTCAGTTGACA
      GGAATGACTGTCACAATCAAATCCAGTACCTGTGAATCAGGCTCCGGATTTGCTGAAGTG
      CAGTTTAATAATGACTGA
      >aggC
      ATGAAAACATCATCTTTCATAATAGTCATTCTTTTGTGTTTTCGAATAGAAAATGTAATC
      GCACATACATTTTCATTTGATGCCTCTTTATTAAACCATGGTAGCGGGGGGATAGACTTA
      ACTCTACTTGAGAAAGGAGGGCAGTTGCCTGGTATTTATCCGGTTGATATAATTTTAAAT
      GGTTCGCGTATTGATTCAAGGGATATATTCTTTTACACAAAAAAAAATAGGCATGGTGAA
      TATTACCTGAAACCCTGTTTAACTCGAGATATTTTGATTAATTACGGAGTAAAAACAGAA
      GAATACCCTAATCTTTTCCGGCAAAATAGTGAAAAAAATAGAGACAGTAGCGATTGTGCT
      GACTTATCAGTGATCCCCCAAGCTACAGAAGACTATCATTTTATAAAACAGCAACTAATA
      CTCGGAATTCCACAAGTTGCGATCCGCCCACCATTGACAGGCATTGCCCATGAAACAATG
      TGGGATGATGGTATATCAGCATTTTTGTTGAACTGGCAAGTAGAGGGGAGTCATTGGGAG
      TATAGAAGTAATACTCGAAATTCTTCAGACAATTTTTGGGCCAGTTTGGAACCTGGAATC
      AATCTCGGATCTTGGCGAATCAGAAATCTGACAACTTGGAATAAGTCTTCCGGGCAGTCA
      GGAAAGTGGGAAAGCTCATATATTCGTGTTGAGCGTGGGTTAAACAATATAAAAAGTCGT
      TTGACGTTTGGGGATGACTATACACCATCAGATATTTTTGACAGTGTTCCTTTTCGTGGG
      GGAATGTTAGGATCTGATGAAAATATGGTGCCATATAATCAACGTGAATTTGCTCCTGTA
      GTGAGAGGTATTGCCCGAACCCAAGCACGAATAGAAGTACGTCAAAATGGCTATCTAATA
      CAGAGTCGTATCGTCTCACCAGGGGCTTTTGCCTTAACAGATCTTCCAGTGACGGGGAAC
      GGTGGTGACTTGCAAGTTTGGGTATTAGAGTCAGACGGCACTATACAGACTTTTAATGTG
      CCATTTACTACTCCGGCTATTGCTCTTCGTGAAGGATATTTGAAATACAATGTAACAGTT
      GGAGAATACCGTCCATCTGACGATAGTATCGAAGGAGCATATCTTGGACAATTGACGGCT
      ATGTATGGTTTACCATGGTCGTTGACAGCGTTTGGTGGAATCCAAGTAAGTGAACATTAT
      CAGGGTAATGCATTGGGATTAGGTTTGTCATTGGGAGGCTTCGGGTCTATATCACTAGAC
      ACGATTTATTCTCGAGGACAACAAAAGGGATATAGTAATGAAATAGGAAAAACTTGGCGC
      GTCCGTTATGATAAGTCCTTTGAGCTAACAGGGACTAGTTTTGCTGCAGGTTATCAAGAT
      TCAAGTGCAGGTTACCATTCATTGGCGGACGTATTGGATACTTATCGTAATGGTACTGCA
      TACAGGAGTTATGATAATAGAATTCGGCGGACCACAATAAACATAAGTCAAGCGCTTGGT
      GAGTGGGGATCTGTTGCGCTAAACGGCGGGCGTGATGAATATCGTGATAAAGTAAAGCAG
      GATTATATAGGTGCATCTTATAGTAATTCATGGAAAGGTATTACCTTCGCAGTAAATTGG
      TCACGCAATAATAATATCGGAGATTATTATAGCAACAGTTTACGCACGGAAAATAATTTA
      AACCTCTGGATGAGTATTCCTATGAAACGCTGGTTGGGGGGGGATGATAAAGGGGTAACA
      GCTACAGCACAGATACAACGTATCACGGGACAAAATACACTTTATGAAACGGGGTTAAAC
      GGACGTGCCTTTGGACAAAAGCTATACTGGGATATACGTGAACAGATAGTACCTGGTAGC
      AAATATGATGCAGATACTAGTCTATTGAATCTTCGCTGGTCAGGTGGTTATGGCGAGCTA
      ACAGGAATGTATAGTTACAATCGTAACACACGCCAGATGAACGTTGGGACGTCTGGAAGC
      ATGGCTATACATAGTGGAGGTATAGCATTTGGTCAGAAAACTGATGATACAATGGCTTTA
      ATTGCTGCACCAGGAATAGCTGGAGCGTCAGTTGGTGGCTGGCCTGGAGTCAGTACTGAT
      TTCCGTGGATATACATTGGTAGGACATGTATCTCCTTATCAGGAGAATATTATTACACTT
      GATCCTACAACTTTTCCTGATAATACAGAAGTGTCGCAAACGGATAGGCGTGTTATTCCA
      ACTAAGGGAGCATTAGTCCAAGCAGAATTTAAGACTCGTGTGGGTAATCGTGCTCTGGTG
      ACACTGACCCGTAAGGACGGAACGCTTTTGCCATTTGGTACGGTTGTTACCCTTGAAAGA
      AAAACGGGAGAAGCATTTGAGTCTGCAGGTGTTGTAGATGATAAGGGGAAGGTGTATCTA
      AGCGGGCTGTCTGAGGCTGGAAAACTGAAGGCGCAGTGGGGGACAAACAGCCAGTGCTAT
      GCGGACTACAAACTGCCACTAAAAAAGGGAATGTCAGGAATTTTTCTGACCCGTGCAGTG
      TGTATGTAA

  1. Dear Kat,

    Good spot in picking up the typo, you are correct about it being AAF/I. We also had to avoid using “/” because its an illegal character for file name in WindowsOS, and we also thought some people would use the primers’ name as its sequence file name.

    Keep up the good work, and please contact me if you ever need to clarify anything else.

    Scott

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s